 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circ_0076248 | |||
| Gene | ZFAND3 | Organism | Human |
| Genome Locus | chr6:37787306-38084515:+ | Build | hg19 |
| Disease | Gliomas | ICD-10 | Malignant neoplasm of Brain, unspecified (C71.9) |
| DBLink | Link to database | PMID | 30506951 |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | Human glioblastoma samples were obtained from surgery operations of Sun Yat"sen Memorial Hospital, Sun Yat"sen University. The normal brain tissues were obtained from the patients of traumatic brain edema that underwent partial brain resection, which was preserved in liquid nitrogen |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward CCTCGATAACCACGCCAACT ReverseTGGAGCGGAATCATCGTCTG | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Lei, B, Huang, Y, Zhou, Z, Zhao, Y, Thapa, AJ, Li, W, Cai, W, Deng, Y (2019). Circular RNA hsa_circ_0076248 promotes oncogenesis of glioma by sponging miR-181a to modulate SIRT1 expression. J. Cell. Biochem., 120, 4:6698-6708. | |||